92
|
OriGene
pcmv6 kan neo Pcmv6 Kan Neo, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcmv6 kan neo/product/OriGene Average 92 stars, based on 1 article reviews
pcmv6 kan neo - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
90
|
Initia Ltd
primer set + template: i. yfg_up_hom_f_bsai + yfg_up_hom_r_xbai Primer Set + Template: I. Yfg Up Hom F Bsai + Yfg Up Hom R Xbai, supplied by Initia Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer set + template: i. yfg_up_hom_f_bsai + yfg_up_hom_r_xbai/product/Initia Ltd Average 90 stars, based on 1 article reviews
primer set + template: i. yfg_up_hom_f_bsai + yfg_up_hom_r_xbai - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Sangon Biotech
forward primer 16s-f Forward Primer 16s F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer 16s-f/product/Sangon Biotech Average 90 stars, based on 1 article reviews
forward primer 16s-f - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Macrogen
primer k12-274-057-f Primer K12 274 057 F, supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer k12-274-057-f/product/Macrogen Average 90 stars, based on 1 article reviews
primer k12-274-057-f - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Vieweg GmbH
primer pairs mttefa-f and mttefa-r Primer Pairs Mttefa F And Mttefa R, supplied by Vieweg GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer pairs mttefa-f and mttefa-r/product/Vieweg GmbH Average 90 stars, based on 1 article reviews
primer pairs mttefa-f and mttefa-r - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Fasmac Co Ltd
primer f9-cap-f Primer F9 Cap F, supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer f9-cap-f/product/Fasmac Co Ltd Average 90 stars, based on 1 article reviews
primer f9-cap-f - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Eurofins
primer: gapdh_f acccagaagactgtggatgg  Primer: Gapdh F Acccagaagactgtggatgg, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer: gapdh_f acccagaagactgtggatgg/product/Eurofins Average 90 stars, based on 1 article reviews
primer: gapdh_f acccagaagactgtggatgg - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
TIB MOLBIOL
c-myc qpcr assay with primer combination c-myc_f/r/tm C Myc Qpcr Assay With Primer Combination C Myc F/R/Tm, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c-myc qpcr assay with primer combination c-myc_f/r/tm/product/TIB MOLBIOL Average 90 stars, based on 1 article reviews
c-myc qpcr assay with primer combination c-myc_f/r/tm - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
PrimerDesign Inc
forward primer csn1s2-5’f Forward Primer Csn1s2 5’f, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer csn1s2-5’f/product/PrimerDesign Inc Average 90 stars, based on 1 article reviews
forward primer csn1s2-5’f - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
gr_meth_1.3_s sequencing primer Gr Meth 1.3 S Sequencing Primer, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gr_meth_1.3_s sequencing primer/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
gr_meth_1.3_s sequencing primer - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Shanghai Generay Biotech
primer: chrna6_f  Primer: Chrna6 F, supplied by Shanghai Generay Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer: chrna6_f/product/Shanghai Generay Biotech Average 90 stars, based on 1 article reviews
primer: chrna6_f - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Shanghai Generay Biotech
primer: kiss1_f  Primer: Kiss1 F, supplied by Shanghai Generay Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer: kiss1_f/product/Shanghai Generay Biotech Average 90 stars, based on 1 article reviews
primer: kiss1_f - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: iScience
Article Title: Lysosomal stress drives the release of pathogenic α-synuclein from macrophage lineage cells via the LRRK2-Rab10 pathway
doi: 10.1016/j.isci.2024.108893
Figure Lengend Snippet:
Article Snippet:
Techniques: Western Blot, Transduction, Immunocytochemistry, Recombinant, SYBR Green Assay, Isolation, In Situ, Software
Journal: Heliyon
Article Title: Non-invasive TMS attenuates neuropathic pain after spinal cord injury associated with enhancing brain functional connectivity and HPA axis activity
doi: 10.1016/j.heliyon.2024.e36061
Figure Lengend Snippet: Key resources table
Article Snippet:
Techniques: Sequencing
Journal: Heliyon
Article Title: Non-invasive TMS attenuates neuropathic pain after spinal cord injury associated with enhancing brain functional connectivity and HPA axis activity
doi: 10.1016/j.heliyon.2024.e36061
Figure Lengend Snippet: Key resources table
Article Snippet:
Techniques: Sequencing